Best Free Pet30a Vector Map Image

Peta(+) vector peta(+) vector petac(+) vector ?petac(+) vector lac operon ? promoter lac operator laci . ex. | ..Novagen ordering technical support tb / petac(+) cloning/expression region agatcgatctcgatcccgcgaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaggaga

Published on Apr 13, 2018 | Under Vector Art | By Grace